Okuma süresi: 5 dk

Bilim ve teknoloji geliştikçe, araştırmalardan elde ettiğimiz verilerin boyutu ve miktarı da aynı ivmeyle artıyor. Veriler arttıkça da, gitgide daha fazla veri deposuna ihtiyaç duyuyoruz. Peki bilgileri hep sabit disklere mi depolamak zorundayız? Bilim kurgu filmlerine taş çıkartacak buluş, canlı organizmalarda biyolojik (genetik) verileri saklamakla görevli olan DNA’nın, farklı verileri de depolayabilmek için de ideal bir sistem olabileceğini öngörüyor. 2017’de Nature (Doğa) dergisinde yayımlanan bu çalışmada, bakteri DNA’sının içine beş karelik bir çizgi film kodlandı ve bakteri nesiller boyu çoğaldıktan sonra film bakteriden tekrar elde edildi! Bu yazımızda, araştırmanın nasıl yapıldığını size anlatmaya çalıştık.

DNA nedir?

DNA (deoksiribonükleik asit), adenin (A), guanin (G), sitozin (C), timin (T) adı verilen dört çeşit nükleik asit bileşiğinin (nükleotit) farklı kombinasyonlarla dizilenerek anlamlı hale gelmesiyle, genleri ve kromozomları oluşturan bir moleküldür. DNA, hücrelerin içindeki RNA ve proteinlerin taslağını içerir. Tüm proteinler, bazı enzimlerle DNA üzerinden üretilir. Örneğin, çok küçük bir protein olan insülin hormonunun insanlardaki gen dizisi (ya da gen sekansı) şudur [1]:

AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCC
AGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCC
TCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCC
AGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACC
CGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGG
CAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGG
CCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAA
TGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACG
CTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCA
TAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAA
GGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGT
GCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGC
ACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGT
GGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACC
GAGAGAGATGGAATAAAGCCCTTGAACCAGC

Bir hücre içindeki tüm DNA (=genom), normalde hücre bölünmeden önce kopyalanır ve genomun iki kopyası hücre bölünmesi sırasında iki hücreye eşit olarak dağıtılır. Fakat daha kısa DNA dizileri laboratuvarda, hücre dışında sentetik olarak da üretilebiliyor. Çok uzun DNA dizilerini laboratuvarda sentezlemek halen mümkün değil; bunun için entegre çipler geliştirmek gelecekteki hedefler arasında. Şu andaki teknoloji, DNA dizilerini halen E. coli bakterisi veya ekmek mayası gibi tek hücreli organizmalara yükleyerek onlara protein ürettirmek üzerine kurulu. Örneğin diyabetli hastalara verilen insülin genelde insan insülin DNA’sının E. coli bakterilerinin içine sokularak, hormonun bakterilere ürettirilip izole edilmesiyle elde ediliyor.

Bilgi deposu olarak canlı hücreler

Peki ya bilgiyi sabit diskler yerine canlı hücreler içinde saklamak istersek? Görünüşe göre bu da mümkün. Temmuz 2017’de Nature (Doğa) dergisinde yayımlanan çalışmada, kısa bir çizgi filmin piksel bilgisi, E. coli bakterisine yüklenmiş!

Bakterilerin virüslere karşı kullandığı doğal bağışıklık sistemi olan CRISPR-Cas [2], virüslerin genomunu kesip biçerek etkisiz hale getirmek üzerine kurulu. Geçtiğimiz yıllarda bu sistem laboratuvarda değiştirilerek, gen mühendisliği alanında kullanılmaya başlandı. Bu yöntemle artık dizisini bildiğimiz bir geni model organizmalardan silebiliyor, yerine yenisini ekleyebiliyor, hatta birkaç nükleotitte değişiklik yapabiliyoruz.

Harvard Tıp Fakültesi Sentetik Biyoloji Bölümü’nde, bu yöntem dahice bir fikirle bakteride veri depolamak üzerine kullanılmış. Düşük çözünürlükteki 5 karelik bir çizgi filmin her karesindeki her bir piksel, DNA lisanında bir barkoda çevrilmiş [3]. Bu şekilde A, G, C, T dizisi kombinasyonlarından oluşan 33 nükleotitlik dizilerden 104 tanesi, birer fotoğraf karesini tanımlamış. Bu teknik, bilgilerin sabit disklerde birler ve sıfırlara çevrilerek depolanmasına çok benziyor, fakat bilim insanları bu bilgileri CRISPR-Cas yöntemiyle bakterilerin DNA’sına yapıştırmış.

Fotoğrafçı Eadweard Muybridge, “Koşan At” çizgi filmi, 1787 [4]. Bakteriye yüklenen çizgi film bu kaynaktan esinlenerek hazırlanmış.

Çizgi film verisi artık bakteri genomunun bir parçası olduğu için, hücreler bölünürken çizgi film de bakterinin doğal DNA’sı ile birlikte kopyalanıp yeni nesillere aktarılmış. Birkaç nesil sonra, bakteriye “yüklenen” çizgi film bakteriden tekrar alınıp okunarak, tekrar görsel hale getirilmiş ve çizgi film tekrar yaratılabilmiş. 

Bu yöntemin ileride kullanılabileceği birçok alan var [5]. Örneğin, bakteri hücresinin doğal işleyişi sırasında zamanla meydana gelen mutasyonların sıklığı, ileride piksellerin değişimiyle belirlenebilir. Fakat çığır açacak alan, bakterileri kayıt cihazı olarak kullanabilmemiz olacak.

Yazar:  Andım Stassen

Editör: Uğur Parlatan, Bilge San

Kaynakça:

[1] İnsülin geni. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information. (2004). 11 Ağustos 2019 tarihinde şu bağlantıdan alınmıştır: https://www.ncbi.nlm.nih.gov/nuccore/NG_007114.1?from=4986&to=6416&report=fasta

[2] Eskici, G. (2018). “Moleküler biyolojide devrim: CRISPR-Cas”. 11 Ağustos 2019 tarihinde şu bağlantıdan alınmıştır: https://epistemturkiye.org/molekuler-biyolojide-devrim-crispr-cas9/

[3] Ledford, H. (2017). “Lights, camera, CRISPR: Biologists use gene editing to store movies in DNA”. 11 Ağustos 2019 tarihinde şu bağlantıdan alınmıştır: https://www.nature.com/news/lights-camera-crispr-biologists-use-gene-editing-to-store-movies-in-dna-1.22288

[4] Muybridge, E., Adam, H.-C., Herbert, S., Muybridge, E., & Muybridge, E. (2010). Eadweard Muybridge, the human and animal locomotion photographs. Köln: Taschen.

[5] Service, R. F. (2017). “DNA could store all of the world’s data in one room”. 11 Ağustos 2019 tarihinde şu bağlantıdan alınmıştır: http://www.sciencemag.org/news/2017/03/dna-could-store-all-worlds-data-one-room

İleri okuma

Shipman, S. L.Nivala, J.Macklis, J. D. & Church, G. M. (2017). CRISPR-Cas encoding of a digital movie into the genomes of a population of living bacteria. Nature. 547(7663): 345–349. doi: 10.1038/nature23017

Görsel lisansı: Creative Commons Zero License for Public Domain, Bilge San tarafından modifiye edilmiştir.